indCAPS (indy-caps)

A tool for generating primers suitable for CAPS or dCAPS analyses of sites with insertions or deletions as well as SNPs.

Please report any errors to hodgens@email.unc.edu along with the sequences you were analyzing and which tool you were attempting to use.

For the generation of dCAPS primers for known alleles, please supply at least 25-30 bases on each side of the indel or SNP location (not including the size of the inserted sequence). Both sequences should be identical except for the indel in question.

Design of dCAPS Primers for Known Alleles

First Sequence:
Second Sequence:
Mismatch Max:

Advanced Options


For the generation of dCAPS primers for CRISPR/Cas9 screening purposes, please supply the wild-type sequence centered on the cut site with at least 25-30 bases on each side of the predicted cut site. Also include the target sequence in the 5'->3' orientation (such that the PAM site would appear to the right of the provided sequence). Fewer than 20 bases can be provided but it is assumed that the cut position is in the -3 position of the provided sequence.



Design of dCAPS Screening Primers for CRISPR/Cas9 Editing Events

WT sequence:
CRISPR target sequence:
Mismatch Max:
Acceptable loss:

Advanced Options


It may be desired to identify a mutant isogenic to another in a CRISPR mutagenesis experiment, e.g. using CRISPR/Cas9 methods to introduce a CRISPR-derived indel in a high order mutant line rather than crossing the high order mutant and isolated CRISPR mutant. If this is the case, the following tool can be used. The user supplies the wild-type and desired mutant sequence and the CRISPR target sequence originally used, and the program searches for a primer which identifies only the specific CRISPR mutation desired.

Note: this process is highly dependent on the expected types of CRISPR edits. Currently only single base pair indels are considered.

Design of dCAPS Screening Primers for Isogenic Mutagenic Events

WT Sequence:
Mutant Sequence:
CRISPR Target Sequence:
Mismatch Max:
Acceptable loss:

Advanced Options
Example output: 
===============================
Enzyme: ApoI
Possible cut site found at position [27].
Problem cut site found at position [].
Sequence 1: TGTGTGTGCAGGGAGAAGCCAAATGTGGATTTTGACAGGGTGGACTCGTATGTGCATCAG
Sequence 2: TGTGTGTGCAGGGAGAAGCCAAATGTGGATTTGACAGGGTGGACTCGTATGTGCATCAG
                                       RAATTY
                 GTGCAGGGAGAAGCCAAATGTGGAaTT
59.76
===============================

The Enzyme name is listed. The possible cut site is the position, moving from the left side of the primer in a 0-based manner, where the proposed cut site is located. "Problem" sites are places on the left side of the indel where an exact match to the enzyme in question can be found.

The proposed match is shown below the sequences in letters, and any problem sites are shown as "." characters.

Next, the proposed primer is shown aligned with the sequences. Comparison of the primer with the sequences should show which bases are modified to break problem cut sites or allow new cut sites to be used.

The melting temperature of the primer is shown last.